agarose gel image (Thermo Fisher)
Thermo Fisher is a verified supplier 
Thermo Fisher manufactures this product 
99
Structured Review
Thermo Fisher
agarose gel image
Agarose Gel Image, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/agarose+gel+image/Agarose/pmc12881135-203-17-29
Average 99 stars, based on 1 article reviews
Agarose Gel Image, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/agarose+gel+image/Agarose/pmc12881135-203-17-29
Average 99 stars, based on 1 article reviews
agarose gel image - by Bioz Stars,
2026-09
99/100 stars
Images
Related Articles
Agarose Gel Electrophoresis:Article Title: NK Cell-Mediated Processing Of Chlamydia psittaci Drives Potent Anti-Bacterial Th1 Immunity Article Snippet: .. Article Title: Ecological genomics in the Northern krill uncovers loci for local adaptation across ocean basins Article Snippet: .. Supplementary Figure 1: Genomic Tip DNA extraction of the reference specimen sample K20 used for long-read and linked-read sequencing, as well as backup sample K21. (A) Article Title: Selection of ssDNA aptamers targeting the serine protease SPSFQ of Acinetobacter baumannii and development of an electrochemical impedance spectroscopy-based ultrasensitive SPSFQ biosensor Article Snippet: The products obtained after the reaction with lambda exonuclease were isolated using the Macherey-Nagel PCR-clean-up kit, and their concentrations were measured spectrophotometrically at 260 nm (Table S5). .. Fig. 3 (A) Agarose gel electrophoresis images of dsDNA sequences obtained after PCR during SELEX rounds, (B) Article Title: Eskişehir Yöresi Sığırlarında Bazı Boynuzsuzluk Varyantlarının Araştırılması Article Snippet: PolC için yapılan PCR ürünleri %2’lik agaroz jel görüntüsü (Invitrogen 50 bç DNA Ladder) Figure 2. .. The Article Title: Scanometric Detection of Tomato Leaf Curl New Delhi Viral DNA using Mono-and Bi- functional AuNPs Conjugated Oligonucleotide Probes Article Snippet: .. Article Title: Serological and molecular evidence of Brucella species in the rapidly growing pig sector in Kenya Article Snippet: .. Tables Table 1 Primers and probes used for real-time PCR Target Gene targeted Sequences of primers and probes (5’ -3’) Fluorophore/ quencher Reference Genus Brucella IS711 Forward GGCCTACCGCTGCGAAT Reverse TTGCGGACAGTCACCATAATG Probe AAGCCAACACCCGGC FAM/-MGBNFQ Matero, 2011 Genus Brucella Bcsp31 Forward GCTCGGTTGCCAATATCAATGC Reverse GGGTAAAGCGTCGCCAGAAG Probe AAATCTTCCACCTTGCCCTTGCCATCA 6-FAM/BHQ1 Probert, 2004 B. abortus IS711 downstream of alkB Forward GCGGCTTTTCTATCACGGTATTC Reverse CATGCGCTATGATCTGGTTACG Probe CGCTCATGCTCGCCAGACTTCAATG JOE/BHQ1 B. melitensis IS711 downstream of BMEI1162 Forward AACAAGCGGCACCCCTAAAA Reverse CATGCGCTATGATCTGGTTACG Probe CAGGAGTGTTTCGGCTCAGAATAATCCACA Texas Red/BHQ2 Table 2 Serological and molecular detection of Brucella antibodies and DNA in pig sera in Kenya Test performed Number tested Number/proportion of positive RBT 700 4 (0.57%) cELISA 700 0 (0.00%) Conventional PCR, genus specific target (bcsp31) 20 4 (20.00%) qPCR, IS711 and bcsp31targets 20 6 (30.00%) qPCR, B. abortus specific target (alkB) 6 4 (66.67%) qPCR, B. melitensis specific target (BMEI1162) 6 0 (0.00%) Page 14/15 Table 3 Results for RBT and Real-Time PCR positive samples (n = 6) Samples Source Sex RBT results Conventional PCR Genus specific (IS711& bcsp31) B. abortus specific B. melitensis specific Serum Central region Peri-urban Female -ve not done +ve +ve -ve Serum Rift valley region Peri-urban Female +ve +ve +ve -ve -ve Serum Central region Peri-urban Female +ve +ve +ve -ve -ve Serum Western region Peri-urban Male -ve not done +ve +ve -ve Serum Central region peri-urban Male +ve +ve +ve +ve -ve Serum Nairobi region Slum Male +ve +ve +ve +ve -ve Figures Figure 1 Page 15/15 An Article Title: CRISPR/Cas9 mediated knock-out of VPREB1 gene induces a cytotoxic effect in myeloma cells Article Snippet: .. Polymerase Chain Reaction:Article Title: NK Cell-Mediated Processing Of Chlamydia psittaci Drives Potent Anti-Bacterial Th1 Immunity Article Snippet: .. Article Title: Selection of ssDNA aptamers targeting the serine protease SPSFQ of Acinetobacter baumannii and development of an electrochemical impedance spectroscopy-based ultrasensitive SPSFQ biosensor Article Snippet: The products obtained after the reaction with lambda exonuclease were isolated using the Macherey-Nagel PCR-clean-up kit, and their concentrations were measured spectrophotometrically at 260 nm (Table S5). .. Fig. 3 (A) Agarose gel electrophoresis images of dsDNA sequences obtained after PCR during SELEX rounds, (B) Article Title: Eskişehir Yöresi Sığırlarında Bazı Boynuzsuzluk Varyantlarının Araştırılması Article Snippet: PolC için yapılan PCR ürünleri %2’lik agaroz jel görüntüsü (Invitrogen 50 bç DNA Ladder) Figure 2. .. The Article Title: Serological and molecular evidence of Brucella species in the rapidly growing pig sector in Kenya Article Snippet: .. Tables Table 1 Primers and probes used for real-time PCR Target Gene targeted Sequences of primers and probes (5’ -3’) Fluorophore/ quencher Reference Genus Brucella IS711 Forward GGCCTACCGCTGCGAAT Reverse TTGCGGACAGTCACCATAATG Probe AAGCCAACACCCGGC FAM/-MGBNFQ Matero, 2011 Genus Brucella Bcsp31 Forward GCTCGGTTGCCAATATCAATGC Reverse GGGTAAAGCGTCGCCAGAAG Probe AAATCTTCCACCTTGCCCTTGCCATCA 6-FAM/BHQ1 Probert, 2004 B. abortus IS711 downstream of alkB Forward GCGGCTTTTCTATCACGGTATTC Reverse CATGCGCTATGATCTGGTTACG Probe CGCTCATGCTCGCCAGACTTCAATG JOE/BHQ1 B. melitensis IS711 downstream of BMEI1162 Forward AACAAGCGGCACCCCTAAAA Reverse CATGCGCTATGATCTGGTTACG Probe CAGGAGTGTTTCGGCTCAGAATAATCCACA Texas Red/BHQ2 Table 2 Serological and molecular detection of Brucella antibodies and DNA in pig sera in Kenya Test performed Number tested Number/proportion of positive RBT 700 4 (0.57%) cELISA 700 0 (0.00%) Conventional PCR, genus specific target (bcsp31) 20 4 (20.00%) qPCR, IS711 and bcsp31targets 20 6 (30.00%) qPCR, B. abortus specific target (alkB) 6 4 (66.67%) qPCR, B. melitensis specific target (BMEI1162) 6 0 (0.00%) Page 14/15 Table 3 Results for RBT and Real-Time PCR positive samples (n = 6) Samples Source Sex RBT results Conventional PCR Genus specific (IS711& bcsp31) B. abortus specific B. melitensis specific Serum Central region Peri-urban Female -ve not done +ve +ve -ve Serum Rift valley region Peri-urban Female +ve +ve +ve -ve -ve Serum Central region Peri-urban Female +ve +ve +ve -ve -ve Serum Western region Peri-urban Male -ve not done +ve +ve -ve Serum Central region peri-urban Male +ve +ve +ve +ve -ve Serum Nairobi region Slum Male +ve +ve +ve +ve -ve Figures Figure 1 Page 15/15 An Infection:Article Title: NK Cell-Mediated Processing Of Chlamydia psittaci Drives Potent Anti-Bacterial Th1 Immunity Article Snippet: .. Amplification:Article Title: NK Cell-Mediated Processing Of Chlamydia psittaci Drives Potent Anti-Bacterial Th1 Immunity Article Snippet: .. Article Title: Serological and molecular evidence of Brucella species in the rapidly growing pig sector in Kenya Article Snippet: .. Tables Table 1 Primers and probes used for real-time PCR Target Gene targeted Sequences of primers and probes (5’ -3’) Fluorophore/ quencher Reference Genus Brucella IS711 Forward GGCCTACCGCTGCGAAT Reverse TTGCGGACAGTCACCATAATG Probe AAGCCAACACCCGGC FAM/-MGBNFQ Matero, 2011 Genus Brucella Bcsp31 Forward GCTCGGTTGCCAATATCAATGC Reverse GGGTAAAGCGTCGCCAGAAG Probe AAATCTTCCACCTTGCCCTTGCCATCA 6-FAM/BHQ1 Probert, 2004 B. abortus IS711 downstream of alkB Forward GCGGCTTTTCTATCACGGTATTC Reverse CATGCGCTATGATCTGGTTACG Probe CGCTCATGCTCGCCAGACTTCAATG JOE/BHQ1 B. melitensis IS711 downstream of BMEI1162 Forward AACAAGCGGCACCCCTAAAA Reverse CATGCGCTATGATCTGGTTACG Probe CAGGAGTGTTTCGGCTCAGAATAATCCACA Texas Red/BHQ2 Table 2 Serological and molecular detection of Brucella antibodies and DNA in pig sera in Kenya Test performed Number tested Number/proportion of positive RBT 700 4 (0.57%) cELISA 700 0 (0.00%) Conventional PCR, genus specific target (bcsp31) 20 4 (20.00%) qPCR, IS711 and bcsp31targets 20 6 (30.00%) qPCR, B. abortus specific target (alkB) 6 4 (66.67%) qPCR, B. melitensis specific target (BMEI1162) 6 0 (0.00%) Page 14/15 Table 3 Results for RBT and Real-Time PCR positive samples (n = 6) Samples Source Sex RBT results Conventional PCR Genus specific (IS711& bcsp31) B. abortus specific B. melitensis specific Serum Central region Peri-urban Female -ve not done +ve +ve -ve Serum Rift valley region Peri-urban Female +ve +ve +ve -ve -ve Serum Central region Peri-urban Female +ve +ve +ve -ve -ve Serum Western region Peri-urban Male -ve not done +ve +ve -ve Serum Central region peri-urban Male +ve +ve +ve +ve -ve Serum Nairobi region Slum Male +ve +ve +ve +ve -ve Figures Figure 1 Page 15/15 An DNA Extraction:Article Title: Ecological genomics in the Northern krill uncovers loci for local adaptation across ocean basins Article Snippet: .. Supplementary Figure 1: Genomic Tip DNA extraction of the reference specimen sample K20 used for long-read and linked-read sequencing, as well as backup sample K21. (A) Sequencing:Article Title: Ecological genomics in the Northern krill uncovers loci for local adaptation across ocean basins Article Snippet: .. Supplementary Figure 1: Genomic Tip DNA extraction of the reference specimen sample K20 used for long-read and linked-read sequencing, as well as backup sample K21. (A) Marker:Article Title: Selection of ssDNA aptamers targeting the serine protease SPSFQ of Acinetobacter baumannii and development of an electrochemical impedance spectroscopy-based ultrasensitive SPSFQ biosensor Article Snippet: The products obtained after the reaction with lambda exonuclease were isolated using the Macherey-Nagel PCR-clean-up kit, and their concentrations were measured spectrophotometrically at 260 nm (Table S5). .. Fig. 3 (A) Agarose gel electrophoresis images of dsDNA sequences obtained after PCR during SELEX rounds, (B) Article Title: Scanometric Detection of Tomato Leaf Curl New Delhi Viral DNA using Mono-and Bi- functional AuNPs Conjugated Oligonucleotide Probes Article Snippet: .. Article Title: CRISPR/Cas9 mediated knock-out of VPREB1 gene induces a cytotoxic effect in myeloma cells Article Snippet: .. Real-time Polymerase Chain Reaction:Article Title: Serological and molecular evidence of Brucella species in the rapidly growing pig sector in Kenya Article Snippet: .. Tables Table 1 Primers and probes used for real-time PCR Target Gene targeted Sequences of primers and probes (5’ -3’) Fluorophore/ quencher Reference Genus Brucella IS711 Forward GGCCTACCGCTGCGAAT Reverse TTGCGGACAGTCACCATAATG Probe AAGCCAACACCCGGC FAM/-MGBNFQ Matero, 2011 Genus Brucella Bcsp31 Forward GCTCGGTTGCCAATATCAATGC Reverse GGGTAAAGCGTCGCCAGAAG Probe AAATCTTCCACCTTGCCCTTGCCATCA 6-FAM/BHQ1 Probert, 2004 B. abortus IS711 downstream of alkB Forward GCGGCTTTTCTATCACGGTATTC Reverse CATGCGCTATGATCTGGTTACG Probe CGCTCATGCTCGCCAGACTTCAATG JOE/BHQ1 B. melitensis IS711 downstream of BMEI1162 Forward AACAAGCGGCACCCCTAAAA Reverse CATGCGCTATGATCTGGTTACG Probe CAGGAGTGTTTCGGCTCAGAATAATCCACA Texas Red/BHQ2 Table 2 Serological and molecular detection of Brucella antibodies and DNA in pig sera in Kenya Test performed Number tested Number/proportion of positive RBT 700 4 (0.57%) cELISA 700 0 (0.00%) Conventional PCR, genus specific target (bcsp31) 20 4 (20.00%) qPCR, IS711 and bcsp31targets 20 6 (30.00%) qPCR, B. abortus specific target (alkB) 6 4 (66.67%) qPCR, B. melitensis specific target (BMEI1162) 6 0 (0.00%) Page 14/15 Table 3 Results for RBT and Real-Time PCR positive samples (n = 6) Samples Source Sex RBT results Conventional PCR Genus specific (IS711& bcsp31) B. abortus specific B. melitensis specific Serum Central region Peri-urban Female -ve not done +ve +ve -ve Serum Rift valley region Peri-urban Female +ve +ve +ve -ve -ve Serum Central region Peri-urban Female +ve +ve +ve -ve -ve Serum Western region Peri-urban Male -ve not done +ve +ve -ve Serum Central region peri-urban Male +ve +ve +ve +ve -ve Serum Nairobi region Slum Male +ve +ve +ve +ve -ve Figures Figure 1 Page 15/15 An Western Blot:Article Title: Serological and molecular evidence of Brucella species in the rapidly growing pig sector in Kenya Article Snippet: .. Tables Table 1 Primers and probes used for real-time PCR Target Gene targeted Sequences of primers and probes (5’ -3’) Fluorophore/ quencher Reference Genus Brucella IS711 Forward GGCCTACCGCTGCGAAT Reverse TTGCGGACAGTCACCATAATG Probe AAGCCAACACCCGGC FAM/-MGBNFQ Matero, 2011 Genus Brucella Bcsp31 Forward GCTCGGTTGCCAATATCAATGC Reverse GGGTAAAGCGTCGCCAGAAG Probe AAATCTTCCACCTTGCCCTTGCCATCA 6-FAM/BHQ1 Probert, 2004 B. abortus IS711 downstream of alkB Forward GCGGCTTTTCTATCACGGTATTC Reverse CATGCGCTATGATCTGGTTACG Probe CGCTCATGCTCGCCAGACTTCAATG JOE/BHQ1 B. melitensis IS711 downstream of BMEI1162 Forward AACAAGCGGCACCCCTAAAA Reverse CATGCGCTATGATCTGGTTACG Probe CAGGAGTGTTTCGGCTCAGAATAATCCACA Texas Red/BHQ2 Table 2 Serological and molecular detection of Brucella antibodies and DNA in pig sera in Kenya Test performed Number tested Number/proportion of positive RBT 700 4 (0.57%) cELISA 700 0 (0.00%) Conventional PCR, genus specific target (bcsp31) 20 4 (20.00%) qPCR, IS711 and bcsp31targets 20 6 (30.00%) qPCR, B. abortus specific target (alkB) 6 4 (66.67%) qPCR, B. melitensis specific target (BMEI1162) 6 0 (0.00%) Page 14/15 Table 3 Results for RBT and Real-Time PCR positive samples (n = 6) Samples Source Sex RBT results Conventional PCR Genus specific (IS711& bcsp31) B. abortus specific B. melitensis specific Serum Central region Peri-urban Female -ve not done +ve +ve -ve Serum Rift valley region Peri-urban Female +ve +ve +ve -ve -ve Serum Central region Peri-urban Female +ve +ve +ve -ve -ve Serum Western region Peri-urban Male -ve not done +ve +ve -ve Serum Central region peri-urban Male +ve +ve +ve +ve -ve Serum Nairobi region Slum Male +ve +ve +ve +ve -ve Figures Figure 1 Page 15/15 An Control:Article Title: Serological and molecular evidence of Brucella species in the rapidly growing pig sector in Kenya Article Snippet: .. Tables Table 1 Primers and probes used for real-time PCR Target Gene targeted Sequences of primers and probes (5’ -3’) Fluorophore/ quencher Reference Genus Brucella IS711 Forward GGCCTACCGCTGCGAAT Reverse TTGCGGACAGTCACCATAATG Probe AAGCCAACACCCGGC FAM/-MGBNFQ Matero, 2011 Genus Brucella Bcsp31 Forward GCTCGGTTGCCAATATCAATGC Reverse GGGTAAAGCGTCGCCAGAAG Probe AAATCTTCCACCTTGCCCTTGCCATCA 6-FAM/BHQ1 Probert, 2004 B. abortus IS711 downstream of alkB Forward GCGGCTTTTCTATCACGGTATTC Reverse CATGCGCTATGATCTGGTTACG Probe CGCTCATGCTCGCCAGACTTCAATG JOE/BHQ1 B. melitensis IS711 downstream of BMEI1162 Forward AACAAGCGGCACCCCTAAAA Reverse CATGCGCTATGATCTGGTTACG Probe CAGGAGTGTTTCGGCTCAGAATAATCCACA Texas Red/BHQ2 Table 2 Serological and molecular detection of Brucella antibodies and DNA in pig sera in Kenya Test performed Number tested Number/proportion of positive RBT 700 4 (0.57%) cELISA 700 0 (0.00%) Conventional PCR, genus specific target (bcsp31) 20 4 (20.00%) qPCR, IS711 and bcsp31targets 20 6 (30.00%) qPCR, B. abortus specific target (alkB) 6 4 (66.67%) qPCR, B. melitensis specific target (BMEI1162) 6 0 (0.00%) Page 14/15 Table 3 Results for RBT and Real-Time PCR positive samples (n = 6) Samples Source Sex RBT results Conventional PCR Genus specific (IS711& bcsp31) B. abortus specific B. melitensis specific Serum Central region Peri-urban Female -ve not done +ve +ve -ve Serum Rift valley region Peri-urban Female +ve +ve +ve -ve -ve Serum Central region Peri-urban Female +ve +ve +ve -ve -ve Serum Western region Peri-urban Male -ve not done +ve +ve -ve Serum Central region peri-urban Male +ve +ve +ve +ve -ve Serum Nairobi region Slum Male +ve +ve +ve +ve -ve Figures Figure 1 Page 15/15 An Cleavage Assay:Article Title: CRISPR/Cas9 mediated knock-out of VPREB1 gene induces a cytotoxic effect in myeloma cells Article Snippet: .. Detection Assay:Article Title: CRISPR/Cas9 mediated knock-out of VPREB1 gene induces a cytotoxic effect in myeloma cells Article Snippet: .. Molecular Weight:Article Title: CRISPR/Cas9 mediated knock-out of VPREB1 gene induces a cytotoxic effect in myeloma cells Article Snippet: .. CRISPR:Article Title: CRISPR/Cas9 mediated knock-out of VPREB1 gene induces a cytotoxic effect in myeloma cells Article Snippet: .. Expressing:Article Title: CRISPR/Cas9 mediated knock-out of VPREB1 gene induces a cytotoxic effect in myeloma cells Article Snippet: .. Transfection:Article Title: CRISPR/Cas9 mediated knock-out of VPREB1 gene induces a cytotoxic effect in myeloma cells Article Snippet: .. Cell Culture:Article Title: CRISPR/Cas9 mediated knock-out of VPREB1 gene induces a cytotoxic effect in myeloma cells Article Snippet: .. |
